View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17093_low_46 (Length: 207)

Name: NF17093_low_46
Description: NF17093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17093_low_46
NF17093_low_46
[»] chr4 (1 HSPs)
chr4 (13-193)||(39211988-39212168)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 39212168 - 39211988
Alignment:
13 tattattctccgcctcgactcaaactcattcaccggttctcttccttcttttaaccaaactgatttaaaagtttttaacatctccgctaataacctcacc 112  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39212168 tattattctccgcctcgactctaactcattcaccggttctcttccttcttttaaccaaactgatttaaaagtttttaacatctccgctaataacctcacc 39212069  T
113 ggtccggttcctgttacgaaaactctttcacggtttaaaccggctttgttttcagataacccgggtttatgtggtgagatt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39212068 ggtccggttcctgttacgaaaactctttcacggtttaaaccggctttgttttcagataacccgggtttatgtggtgagatt 39211988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University