View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_high_18 (Length: 242)
Name: NF17094_high_18
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 47958897 - 47958676
Alignment:
| Q |
16 |
cttatttctttatttatctataaactatataatatacaatttgacnnnnnnnnntatctatggaaataacaaagctaaccagttaaacgaggcaagataa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47958897 |
cttatttctttatttatctataaactatataatatacaatttgacaaaaaaaa-tatctatggaaataacaaagctaaccagttaaacgaggcacgataa |
47958799 |
T |
|
| Q |
116 |
atttacctgtagaattctcacaaaaaatgagactcaaagaagaaggaagatggtctaagatgaccatttacaagaatatgagtggcctaaacttgcttga |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47958798 |
atttatctgtagaattctcacaaaaaatgagactcaaagaagaaggaggatggtctaagatgaccatttacaagaatatgagtggcctaaacttgcttga |
47958699 |
T |
|
| Q |
216 |
gaatccgtatactattaacttct |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47958698 |
gaatccgtatactattaacttct |
47958676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University