View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_high_19 (Length: 241)
Name: NF17094_high_19
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 1792359 - 1792234
Alignment:
| Q |
1 |
gttttcacgaaaatggtaatgagaagcgtacttagagagatgtgggattgtaaagacttgagtacttacttttaaaggcaaagatgattggtggtcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1792359 |
gttttcacgaaaatggtaatgagaagcgtacttagagagatgtgggattgtagagacttgagt----acttttaaaggcaaagatgattggtggtcaaag |
1792264 |
T |
 |
| Q |
101 |
gaaagaagcttgttaagacgattttttgag |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
1792263 |
gaaagaagcttgttaagacaattttttgag |
1792234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 122 - 205
Target Start/End: Complemental strand, 1791842 - 1791759
Alignment:
| Q |
122 |
ttttttgagtgaaaactcattttcaatctttaagaaaattgcatatatgaaatagaaaactgcatatattataatttggtcttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1791842 |
ttttttgagtgaaaactcattttcaatctttaagaaaactgcatatatgaaatagaaaactgcatatattataatttggtcttg |
1791759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University