View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_high_21 (Length: 218)
Name: NF17094_high_21
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 14924103 - 14924300
Alignment:
| Q |
10 |
gaagcaaaggtagtatgagatctccgagtgatgtaaaaactgttttaatttgctcgaaccgaaccaaaacgaaattgctatagaatcgctcaaataactg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924103 |
gaagaaaaggtagtatgagatctccgagtgatgtaaaaactgttttaatttgctcgaaccgaaccaaaacgaaattgctatagaatcgctcaaataactg |
14924202 |
T |
|
| Q |
110 |
aaacatcgattgtgccg-------gttcaaaagttgaattgtccaattctgttcaggatttgaaatattgattctgatatatactctttgaatcagtt |
200 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14924203 |
aaacatcgatcgtgccggttcacagttcaaaagttgaattgtccgattctgttctggatttgaaatattgattctgatatatactctttgagtcagtt |
14924300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University