View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_low_13 (Length: 327)
Name: NF17094_low_13
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 11 - 311
Target Start/End: Original strand, 37562310 - 37562610
Alignment:
| Q |
11 |
cacagaattctgttccatcatctggatcatcaccaaaaccgaaaagtcatgttgcagcacaagccacttcaccaactcccgagcactcatatgacgattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
37562310 |
cacagaattctgttccatcatctggatcatcaccaaaaccgaaaagtcatgttgcagcacaagccacttctccaactcctgagcactcatatgacgattt |
37562409 |
T |
 |
| Q |
111 |
ttggtttctatttgcaccaccgccaccaccacctcctcctcattctacttttgattcaacgcatgatgacaaacaacggaaagcaattattgttgctgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37562410 |
ttggtttctatttgcaccaccgccaccaccacctcctcctcattctacttttgattcaacgcatgatgacaaacaacggaaagcaattattgttgctgta |
37562509 |
T |
 |
| Q |
211 |
actgcatcaggaattataatcttaataggcttgttgttatgctgttgcgaggtgaggaagagcaaaaaagtagacaaaaatgacaagcctttactcatat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37562510 |
actgcatcaggaattataatcttaataggcttgttgttatgctgtcgcgaggtgaggaagagcaaaaaagtagacaaaaatgacaagcctttactcatat |
37562609 |
T |
 |
| Q |
311 |
t |
311 |
Q |
| |
|
| |
|
|
| T |
37562610 |
t |
37562610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University