View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_low_18 (Length: 255)
Name: NF17094_low_18
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 33223060 - 33222836
Alignment:
| Q |
19 |
caaataacctatctattatgacatcttcattctcactaattttgaagtgaattctcaaagtctcgaagtccttaaatagtcatccacacttagggttggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223060 |
caaataacctatctattatgacatcttcattctcgctaattttgaagtgaattctcaaagtctcgaagtccttaaatagtcatccacacttagggttggt |
33222961 |
T |
 |
| Q |
119 |
tcaaccttttggannnnnnnnnatgtagccccttgatagtaacatggtatacatctcttcctaaaaatttcttcaaaacaatctcaactaactatgttct |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33222960 |
tcaaccttttgga-ttttttttatgtagccccttgatagtaagatggtatatatctcttcctaaaaacttcttcaaaacaatctcaactaactatgttct |
33222862 |
T |
 |
| Q |
219 |
taataagatgg--tattattcatctc |
242 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
33222861 |
taataagatggtatattattcatctc |
33222836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University