View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17094_low_23 (Length: 212)
Name: NF17094_low_23
Description: NF17094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17094_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 25 - 195
Target Start/End: Original strand, 25740526 - 25740696
Alignment:
| Q |
25 |
tacttatttacatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggctttttattccaaagcatttccctggtatgt |
124 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25740526 |
tacttatttgcatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggctttttattccaaagcatttccctggtatgt |
25740625 |
T |
|
| Q |
125 |
tacacttttacttaaacttaacagtataatccgtctcatagtctattaaaagttatattagctcctaaatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25740626 |
tacacttttacttaaacttaacagtataatccgtttcatagtctattaaaagttatattagcacctaaatg |
25740696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 25 - 162
Target Start/End: Original strand, 25744226 - 25744363
Alignment:
| Q |
25 |
tacttatttacatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggctttttattccaaagcatttccctggtatgt |
124 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25744226 |
tacttatttgcatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggctttttattccaaagcatttcccaggtatgt |
25744325 |
T |
|
| Q |
125 |
tacacttttacttaaacttaacagtataatccgtctca |
162 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
25744326 |
tacacttttacttgaacttaactgtatagtccttctca |
25744363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 25 - 99
Target Start/End: Original strand, 17383430 - 17383504
Alignment:
| Q |
25 |
tacttatttacatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggcttttt |
99 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17383430 |
tacttatttttatgactatgcagaggagagattggaaaatgaattgctttagttgctgttgttttaaggcttttt |
17383504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 25 - 99
Target Start/End: Original strand, 8535015 - 8535089
Alignment:
| Q |
25 |
tacttatttacatgactacgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggcttttt |
99 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8535015 |
tacttattttcatgactatgcagaggagagattggaaaatggattgctttagttgctgttgttttaaggcttttt |
8535089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University