View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17095_low_19 (Length: 251)
Name: NF17095_low_19
Description: NF17095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17095_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 232
Target Start/End: Original strand, 50229692 - 50229915
Alignment:
| Q |
9 |
agcagagaacctttttgaagaattttgnnnnnnnnggggtattacttgtaatcttaaataatcttttgagtatttttatagataatcacgaagctttcta |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229692 |
agcagagaacctttttgaagaattttgttttttttggggtattacttgtaatcctaaataatcttttgagtatttttatagataatcacgaagctttcta |
50229791 |
T |
|
| Q |
109 |
cgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtttcttcaactataga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229792 |
cgaggatgccgagcttagaaagcagaatgaaggtactcagagaaattgcttctgagaacaatattactctgcagcttgaacaagtttcttcaactataga |
50229891 |
T |
|
| Q |
209 |
tgaggtacaaaattaatgcgatct |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50229892 |
tgaggtacaaaattaatgcgatct |
50229915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University