View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17095_low_20 (Length: 237)
Name: NF17095_low_20
Description: NF17095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17095_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 39557370 - 39557168
Alignment:
| Q |
13 |
attatactttctaactcatctcctgatgtattgatgttggttgatcatatggaggtagtatttatttannnnnnnnataaatatttttgaggaacatatg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39557370 |
attatattttctaactcatctcctgatgtattgatgttggttgatcatatggaggtagtatttatttattttttttataaatatttttgaggaacatatg |
39557271 |
T |
 |
| Q |
113 |
gaggtagtattgtaaaagtaatgtgaggtcttgcttgtactataagtggtaaattgttcatttggagtgtatatgtagggagtaatttgtctaatgtggg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39557270 |
gaggtagtattgtaaaagtaatgtgaggtcttgcttgtactataagtggtaaattgttcatttggagtgtatatgtagggagtaatctgtctaatgtggg |
39557171 |
T |
 |
| Q |
213 |
tcg |
215 |
Q |
| |
|
||| |
|
|
| T |
39557170 |
tcg |
39557168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University