View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17095_low_21 (Length: 236)
Name: NF17095_low_21
Description: NF17095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17095_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43620693 - 43620913
Alignment:
| Q |
1 |
ctcagtggttgtcttcattgccttgaacagaaaaacgtgtttattacaannnnnnnn-gttggataaagacgtgtttacgtatagtatttgtatgaagtc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620693 |
ctcagtggttgtcttcattgccttgaacagaaaaacgtgtttattacaatttttttttgttggataaagacgtgtttacgtatagtatttgtatgaagtc |
43620792 |
T |
|
| Q |
100 |
tcaagttaaacatatctctcctctcaaactcaaagcaaaagataacagaagaaaaaacctaataatgaaaggaatgaagccatatgtggttgtgtttgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43620793 |
tcaagttaaacatatctctcctctcaaactcaaagcaaaagataacagaagaaaaaacctaataatgaaaggaatgaagccatatgtggttgtgtttgtg |
43620892 |
T |
|
| Q |
200 |
atacaaactatatacgcaatt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43620893 |
atacaaactatatacgcaatt |
43620913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University