View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17095_low_23 (Length: 223)
Name: NF17095_low_23
Description: NF17095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17095_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 14517330 - 14517118
Alignment:
| Q |
1 |
aacggtttcgcgatttcatctacagagtttttgttgaagacacttcttgagggctttagtttttgaaatctgaccaatgcacattagttggagggtattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14517330 |
aacggtttcgcgatttcatctacagagtttttgttgaagacacttcttgagggctttagtttttgaaatctgaccaatgcacattagttggagggtattt |
14517231 |
T |
|
| Q |
101 |
tgtgattgatatgttacacatttctgaagtttgttcattttccctccctatagtttgtcagtttttcatttaattttagtcacagctaatgtatgttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14517230 |
tgtgattgatatgttacacatttctgaagtttgttcattttccctccctatagtttgtcagtttttcatttaattttagtcacagctaatgtatgttgta |
14517131 |
T |
|
| Q |
201 |
gtgtagattttga |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14517130 |
gtgtagattttga |
14517118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 4196897 - 4196941
Alignment:
| Q |
1 |
aacggtttcgcgatttcatctacagagtttttgttgaagacactt |
45 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
4196897 |
aacgctttcgcgatttcatcttcagagtttttgtagaggacactt |
4196941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University