View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17097_high_4 (Length: 224)
Name: NF17097_high_4
Description: NF17097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17097_high_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 3294421 - 3294210
Alignment:
| Q |
13 |
aaggtggtagacaaagacaaagtgaaaaaagaaggcatgatggaacaaatcaaacgtgaaatttctgtcatgaggttagtaaaacatccaaacatcgtca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3294421 |
aaggtggtagacaaagacaaagtgaaaaaagaaggcatgatggaacaaatcaaacgtgaaatttctgtcatgaggttagtaaaacatccaaacatcgtta |
3294322 |
T |
 |
| Q |
113 |
accttaaagaagtcatggcaacaaaaactaaaatcttgtttgtcatggaatatgcacgtggtggcgaattattcgagaaggtagcaaaaggtaaatttaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294321 |
accttaaagaagtcatggcaacaaaaaccaaaatcctgtttgtcatggaatatgcacgtggcggcgaattattcgagaaggtagcaaaaggtaaatttaa |
3294222 |
T |
 |
| Q |
213 |
ggaagaacttgc |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3294221 |
ggaagaacttgc |
3294210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University