View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17098_low_3 (Length: 376)
Name: NF17098_low_3
Description: NF17098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17098_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 6532926 - 6532726
Alignment:
| Q |
22 |
gtgctttggtctaatggaccagaatctcaatctccaactgttgggaataaacaatgtgctggtaaagatttcaccacattgatttcaagacttttggttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6532926 |
gtgctttggtctaatggaccagaatctcaatctccaactgttgggaataaacaatgtgctggtaaagatttcaccacattgatttcaagacttttggttg |
6532827 |
T |
|
| Q |
122 |
ttgaactttttcttaggtatgattcctttgagattcaagttggaaattcacctttaggtccttctattaccctcacttctctaaagagatcaagcttcta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6532826 |
ttgaactttttcttaggtatgattcctttgagattcaagttggaaattcacctttaggtccttctattaccctcacttctctaaagagatcaagcttcta |
6532727 |
T |
|
| Q |
222 |
a |
222 |
Q |
| |
|
| |
|
|
| T |
6532726 |
a |
6532726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 249 - 360
Target Start/End: Complemental strand, 6532698 - 6532591
Alignment:
| Q |
249 |
agtgagtagttataagatgattaattgttattgtaatgttgtaaactagtatgtcttgatttcatttaatgttgatatttaagtgtagttttttggatgg |
348 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6532698 |
agtgagtagttataagatgatt----gttattgtaatgttgtaaactagtatgtcttgatttcatttaatgttgatatttaagtgtagttttttggatgg |
6532603 |
T |
|
| Q |
349 |
atactagatatt |
360 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6532602 |
atactagatatt |
6532591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University