View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17099_high_10 (Length: 313)
Name: NF17099_high_10
Description: NF17099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17099_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 36526681 - 36526378
Alignment:
| Q |
1 |
ttatatcatttgtgtttctcaaattcagttttggcatcttggataagctcaaataattgtagaattaccctcctacatgttgaatttcttgatcattctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
36526681 |
ttatatcatttgtgtttctcaaattcagttttggcatcttggataagctcaaacaattgtagaatgaccctcctacatgttgaatttcttgatcattttc |
36526582 |
T |
|
| Q |
101 |
tctttannnnnnnaagacttttttatgtgttgtataaactaaatacttttatctttaccttgatatttatggcatatatattcattgtagtaatctccnn |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36526581 |
tctttatttttttaagacttttttatgtgttgtataaaataaatacttttatctttaccttgatatttatggcatatatattcattgtagtaatctcc-t |
36526483 |
T |
|
| Q |
201 |
nnnnnnnnnnnggattcggtgttggtcaacatttatctcctaggagaacatatgcttcnnnnnnncttttataatagaacatatgtcattgattgtgaga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
36526482 |
tttttttttttggattcggtgttggtcaacatttatctcctaggagaacatatgcttctttttttcttttataatagaacatatgccattgattgtgaga |
36526383 |
T |
|
| Q |
301 |
ataat |
305 |
Q |
| |
|
||||| |
|
|
| T |
36526382 |
ataat |
36526378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University