View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17099_low_13 (Length: 251)
Name: NF17099_low_13
Description: NF17099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17099_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 240
Target Start/End: Original strand, 3063230 - 3063454
Alignment:
| Q |
13 |
attgtttctctggttgctcgcttactccaaaagccatttcatagtacacttgcaacaactaggctatgcgacgcaaaataataaacctaggtccaatatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
3063230 |
attgtttctctggttgctcgcttactccaaaagccatttcatagtacacttgcaacaactaggctatgcgacacaaaataataaaactaggtccaatatc |
3063329 |
T |
|
| Q |
113 |
tagagtagttgggcgctaccaatacccccctgctgaacagcagctttatcctcaaggctaacattttgtgttgacttgttgagctcatccaacggctggc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3063330 |
tagagtagttgggcgctaccaatacccccctcctgaacagcagctttatcctcaaggctaacgttttgtgttgacttgttgagctcatccaacggctg-- |
3063427 |
T |
|
| Q |
213 |
tgctgctgctggcatccaagggcttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3063428 |
-gctgctgctggcatccaagggcttcat |
3063454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University