View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17099_low_17 (Length: 234)
Name: NF17099_low_17
Description: NF17099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17099_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 15180297 - 15180517
Alignment:
| Q |
17 |
cacagaaggaattaaagttcaaagttgccatgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggcggagacaaaggcgaaagataa |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
15180297 |
cacagaaggaattaaagttcaaagtggccatgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggtggagacaaaggcgaaagacaa |
15180396 |
T |
|
| Q |
117 |
-tttcgggaactgcaattgatcttgctagcaatgacaatgctatcaccgat---------------------attggaattgttgttaggggacaagcta |
194 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15180397 |
ttttctggaactgcaattgatcttgctagcaatgacaatgctatcaccgatgtcgcaattttctcagcagccattggaattgttgttaggggacaagcta |
15180496 |
T |
|
| Q |
195 |
acataatcacaggtgtgcatt |
215 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15180497 |
acataatcacaggtgtgcatt |
15180517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 38859568 - 38859516
Alignment:
| Q |
45 |
catgaaaccttcatatcaagtagttttcttggacaacactcaacagtcggcgg |
97 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38859568 |
catgagacattcatatcaagttgttttcttggacaacactcaacagttggcgg |
38859516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University