View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17099_low_21 (Length: 205)
Name: NF17099_low_21
Description: NF17099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17099_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 21664627 - 21664703
Alignment:
| Q |
20 |
gagctaacttcatttctgttctctcgcttgtttcttctagtttttccgatttcactctattaaccagaattacgatg |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21664627 |
gagctaacttcatttctgttatctcgcttgtttcttctagtttttccgatttcactctagtaaccagaattacgatg |
21664703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 21664704 - 21664751
Alignment:
| Q |
122 |
ccgaagacccttataaaataaaaataaataaataatctgttttctctc |
169 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21664704 |
ccgaagacccttgtaaaataaaaataaataaaaaatctgttttctctc |
21664751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University