View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17099_low_22 (Length: 204)
Name: NF17099_low_22
Description: NF17099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17099_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 5390479 - 5390557
Alignment:
| Q |
12 |
gagcagagatgtaaagaagttaagagaattaagaaatagtgaaagttagaaaattaccaacaagtgaacattattcttt |
90 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5390479 |
gagcagaggtgtaaagaagttaagagaattaagaaatagtgaaagttagaaaattaccaacaagtgaacattattcttt |
5390557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 5394051 - 5394118
Alignment:
| Q |
20 |
atgtaaagaagttaagagaattaagaaatagtgaaagttagaaaattacc-aacaagtgaacattatt |
86 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
5394051 |
atgtgaagaagttaagagaattaagaaatagcgaaagtgtgaacattaccaaacaagtgaacattatt |
5394118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University