View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709R-Insertion-14 (Length: 143)
Name: NF1709R-Insertion-14
Description: NF1709R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709R-Insertion-14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 8 - 142
Target Start/End: Complemental strand, 1247600 - 1247466
Alignment:
| Q |
8 |
aagaacaccatcgttctggaaacttccagaagcgcttcttggatcggtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1247600 |
aagaacaccatcgttctggaaacttccagaagcgcttcttgggtcagtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaa |
1247501 |
T |
 |
| Q |
108 |
gatgatggcattgtgaatgttaagggttcttctct |
142 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
1247500 |
gatgatgggattgtgaatgttaagggttcttctct |
1247466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 115; Significance: 9e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 9e-59
Query Start/End: Original strand, 8 - 142
Target Start/End: Complemental strand, 42014372 - 42014238
Alignment:
| Q |
8 |
aagaacaccatcgttctggaaacttccagaagcgcttcttggatcggtgaggtaactatcgagtgtgtcagagacggtgattggtgaggaatgagaggaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42014372 |
aagaacaccatcgttctggaaacttccagaagcgcttcttgggtcggtgaggtaactatcgagtgtgtcagagacggtgatcggtgaggaatgagaggaa |
42014273 |
T |
 |
| Q |
108 |
gatgatggcattgtgaatgttaagggttcttctct |
142 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||| |
|
|
| T |
42014272 |
gatgatgggattgtgaatgttaaagattcttctct |
42014238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University