View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709R-Insertion-8 (Length: 318)
Name: NF1709R-Insertion-8
Description: NF1709R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709R-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 71 - 318
Target Start/End: Original strand, 32773412 - 32773664
Alignment:
| Q |
71 |
cacaaaatgatgtactgcatgcaacatatttgata----attagatctttaatgaactgcaacggatttgaacgaactgccttcgatggaaaattagcag |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773412 |
cacaaaatgatgtactgcatgcaacatatttgatatataattagatctttaatgaactgcaacggatttgaacgaactgccttcgatggaaaattagcag |
32773511 |
T |
 |
| Q |
167 |
attttcaatagaagatgaaagaagttgacgatgaggaggcagactcgggaaatgtgccaggat-aaaaaatattcattaaaacaattaaattgtagttta |
265 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32773512 |
attttcaatagaagatgaaagatgttgacgataaggaggcagactcgggaaatgtgccaggataaaaaaaaattcattaaaacaattaaattgtagttta |
32773611 |
T |
 |
| Q |
266 |
catgtttacccatcactttgaattactttgaaaaggaagtgttgggtttttgg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773612 |
catgtttacccatcactttgaattactttgaaaaggaagtgttgggtttttgg |
32773664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University