View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_13 (Length: 398)
Name: NF1709_high_13
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 11 - 380
Target Start/End: Complemental strand, 1782264 - 1781895
Alignment:
| Q |
11 |
cacagatccacccttttcttgtgtttttctcactttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttgattaaac |
110 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1782264 |
cacagatcaaccctcttcttgtgtttttctcaccttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttaattaaac |
1782165 |
T |
 |
| Q |
111 |
ttatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782164 |
ttatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttag |
1782065 |
T |
 |
| Q |
211 |
ttttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagttt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782064 |
ttttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagttt |
1781965 |
T |
 |
| Q |
311 |
tgagggtctcacgaagtcagcatgtaggatgtacatgttcaaaggttatgtgatgggagatgggtgtatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1781964 |
tgagggtctcacgaagtcagcatgtaggatgtacatgttcaaaggttatgtgatgggagatgggtgtatg |
1781895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University