View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_32 (Length: 268)
Name: NF1709_high_32
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 254
Target Start/End: Complemental strand, 37505362 - 37505138
Alignment:
| Q |
30 |
aaccggtgccgaattcatgaagatcacgacggtatatttcgatgacggattcggatttttcgccgacggttttgattaggttgccgatgttcttccacgc |
129 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505362 |
aacctgtgccgaattcatgaagatcacgacggtatatttcgatgacggattcggatttttcgccgacggttttgattaggttgccgatgttcttccacgc |
37505263 |
T |
 |
| Q |
130 |
ggcggtgggattgaacggcacgtttggcgagtcgctggaggaagcggtgtttgtttcggatcctgatgggtccgggtcgtcggagaaaacggttttgaag |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505262 |
ggcggtgggattgaacggcacgtttagcgagtcgctggaggaagcggtatttgtttcggatcctgatgggtccgggtcgtcggagaaaacggttttgaag |
37505163 |
T |
 |
| Q |
230 |
aaattcattgagaaatggtggaatg |
254 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
37505162 |
aaattcattgagaaatggttgaatg |
37505138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 237
Target Start/End: Complemental strand, 40217142 - 40217108
Alignment:
| Q |
203 |
gggtcgtcggagaaaacggttttgaagaaattcat |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40217142 |
gggtcgtcggagaaaacggatttgaagaaattcat |
40217108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University