View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_36 (Length: 250)
Name: NF1709_high_36
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_36 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 32567092 - 32566854
Alignment:
| Q |
12 |
atgaacaatctgtgaagtaatggtttggactttggatttcgtagttgtaggttcnnnnnnnncttctttcctcagtgatcatgatgtagaatatggtggt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32567092 |
atgaacaatctgtgaagtaatggtttggactttggatttcgtagttgtaggttcttttttttcttctttcctcagtgatcatgatgtagaatatggtggt |
32566993 |
T |
|
| Q |
112 |
gaaagtctcaagtgtatatggacttaaaacagctatttgcttcaccccaaaattcatgaataacttgtaatatatcagcaccgtttgtgaaaattctgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32566992 |
gaaagtctcaagtgtatatggacttaaaacagctatttgcttcaccccaaaattcatgaataacttgtaatatatcagcaccgtttgtgaaaatcctgtt |
32566893 |
T |
|
| Q |
212 |
gtcacaaagggcaaagaagatgttccctttcagaaccta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32566892 |
gtcacaaagggcaaagaagatgttccctttcagaaccta |
32566854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University