View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_42 (Length: 248)
Name: NF1709_high_42
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 42217076 - 42217291
Alignment:
| Q |
16 |
ttacaattaaggcaatgagggtgaagaaggagaagagccatgcgaatatatcagccatactccttctctaaattggtgatttttcagtacttgtattgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217076 |
ttacaattaaggcaatgagggtgaagaaggagaagagccatgcgaatatatcagccatactccttctctaaattggtgatttttcagtacttgtattgta |
42217175 |
T |
 |
| Q |
116 |
tcttaggcactcaataaatcaatcgacgaaaactgcgcacgatagcagctttgcggggattgtgcgcagcacggagaggaacagaagaaagaaacctatg |
215 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217176 |
tctta-gctctcaataaatcaatcgacgaaaactgcgcacgatagcagctatgcggagattgtgcgcagcacggagaggaacagaagaaagaaacctatg |
42217274 |
T |
 |
| Q |
216 |
aggatcgaaggtacaat |
232 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
42217275 |
aggatcggaggtacaat |
42217291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University