View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_46 (Length: 239)
Name: NF1709_high_46
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 18 - 124
Target Start/End: Complemental strand, 18223276 - 18223170
Alignment:
| Q |
18 |
gattctgcacaatttttgtttccatttttggattcaataaatgttcagacaaatcgactataaacatgatcttacacagtactgtgaaagtgaaagcaga |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18223276 |
gattctgcacagtttttgtttccatttttggattcaataaatgttgagacaaatcgactataaacatgatcttacacagtactgtgaaagtgaaagcaga |
18223177 |
T |
|
| Q |
118 |
ttctctg |
124 |
Q |
| |
|
||||||| |
|
|
| T |
18223176 |
ttctctg |
18223170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 23735531 - 23735495
Alignment:
| Q |
18 |
gattctgcacaatttttgtttccatttttggattcaa |
54 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23735531 |
gattctgctcaatttttgtttccatttttggattcaa |
23735495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University