View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_high_47 (Length: 238)
Name: NF1709_high_47
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 24355932 - 24355717
Alignment:
| Q |
1 |
tcataagccactaaaatgaaatgaaactattatgcattttaggcagaannnnnnnnaaaagtctgcaaccacaatctgagcctcgaccacaaaatatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24355932 |
tcataagccactaaaatgaaatgaaactattatgcattttaggcagaatttttttaaaaagtctgcaaccacaatctgagcctcgaccacaaaatatttc |
24355833 |
T |
 |
| Q |
101 |
aacacaactgcgattgagaccacatcagtctcaatcgattgtgattctcttagatatcaaagatcataacgcggcagctatttgaaacattggtttaaag |
200 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24355832 |
aacacaactgcaattgagaccgcatcagtctcaatcgattgtgattttcttagatatcaaagatcataacgcggcagctatttaaaacattggtttaaag |
24355733 |
T |
 |
| Q |
201 |
aactgtaaaccagttt |
216 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
24355732 |
aactgtaatccagttt |
24355717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University