View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1709_high_50 (Length: 237)

Name: NF1709_high_50
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1709_high_50
NF1709_high_50
[»] scaffold0929 (1 HSPs)
scaffold0929 (1-138)||(2171-2312)
[»] chr7 (1 HSPs)
chr7 (1-137)||(6364115-6364253)
[»] chr6 (2 HSPs)
chr6 (1-80)||(6554147-6554226)
chr6 (3-73)||(6543639-6543709)
[»] chr5 (2 HSPs)
chr5 (3-48)||(15256695-15256740)
chr5 (3-48)||(15265220-15265265)


Alignment Details
Target: scaffold0929 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: scaffold0929
Description:

Target: scaffold0929; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 2312 - 2171
Alignment:
1 ataatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaagatgg----agggtgagatcagctgaa 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||    
2312 ataatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaagatggagggagggtgagatcagctgaa 2213  T
97 gaaaaaagacttcatttgcacaaaaattaacaaatgaaatag 138  Q
    |||||||||||||||||||||||||||| |||||||||||||    
2212 gaaaaaagacttcatttgcacaaaaattgacaaatgaaatag 2171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 6364253 - 6364115
Alignment:
1 ataatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaagatggagg--gtgagatcagctgaaga 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||    
6364253 ataatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaagatggagggtgtgagatcagcagaaga 6364154  T
99 aaaaagacttcatttgcacaaaaattaacaaatgaaata 137  Q
    || ||||||||||||||||| ||||| ||||||||||||    
6364153 aagaagacttcatttgcacacaaattgacaaatgaaata 6364115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 6554226 - 6554147
Alignment:
1 ataatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaagatggag 80  Q
    ||||||||||||| |||||||| ||||| || ||||| || |||||||||||||||||| |||| |||||||||||||||    
6554226 ataatgattgtgttcattggtgtttgccagggcctatagatacatggagtgatttcttgctagaaatgttgaagatggag 6554147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 73
Target Start/End: Complemental strand, 6543709 - 6543639
Alignment:
3 aatgattgtgtgcattggtgcttgcctggacctattgacacatggagtgatttcttgttagatatgttgaa 73  Q
    ||||||||||| |||||||| || ||||||||| |||| ||||||| ||| || ||| || ||||||||||    
6543709 aatgattgtgttcattggtgtttacctggacctgttgatacatggaatgagttattgctatatatgttgaa 6543639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 15256740 - 15256695
Alignment:
3 aatgattgtgtgcattggtgcttgcctggacctattgacacatgga 48  Q
    ||||||||||| |||||||| |||||||||||||| ||||||||||    
15256740 aatgattgtgttcattggtgtttgcctggacctatagacacatgga 15256695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 15265265 - 15265220
Alignment:
3 aatgattgtgtgcattggtgcttgcctggacctattgacacatgga 48  Q
    ||||||||||| |||||||| ||||||||||| ||||| |||||||    
15265265 aatgattgtgttcattggtgtttgcctggaccaattgatacatgga 15265220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University