View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_low_18 (Length: 353)
Name: NF1709_low_18
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 131 - 210
Target Start/End: Complemental strand, 41914836 - 41914757
Alignment:
| Q |
131 |
tacagggattggaaactaaggagctcgagggtctatatattaaggggaagagtgtgaaaaggaaggtatcaagaacacac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41914836 |
tacagggattggaaactaaggagctcgagggtctatatattaaggggaagagtgtgaaaaggaaggtatcaagaacacac |
41914757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 6 - 71
Target Start/End: Complemental strand, 41914956 - 41914891
Alignment:
| Q |
6 |
aaaaatgacaatgcagaagtgttttgagaagctgaactgaaacttcgtataatcccgctaattaag |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41914956 |
aaaaatgacaatgcagaagtgttttgagaagctgaactgaaacttcgtataatcccgctaattaag |
41914891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University