View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_low_29 (Length: 303)
Name: NF1709_low_29
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 94 - 295
Target Start/End: Complemental strand, 11812231 - 11812027
Alignment:
| Q |
94 |
ttatgttggtgtatttttt-ggag--gttttatcttaacagaaattttatggtttattacacaacaaatcaattcagttcgaaaacatacagtattgttt |
190 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11812231 |
ttatcttggtgtattttttcggagatgttttatcttaacataaattttacggttcattacacaacaaatcaattcagttcgaaaacatacagttttgttt |
11812132 |
T |
|
| Q |
191 |
tttgtaaaaattgttaaaatagttagaatataaattgagtttgttagtgagttaaagttcgttgctcactctagttagttagttaatcgcactggttagt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11812131 |
tttgtaaaaattgttaaaatagttagaatataaattgagttagttagtgagttaaagttctttactcactctagttagttagttaatcgcactggttagt |
11812032 |
T |
|
| Q |
291 |
ataat |
295 |
Q |
| |
|
||||| |
|
|
| T |
11812031 |
ataat |
11812027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University