View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1709_low_46 (Length: 248)
Name: NF1709_low_46
Description: NF1709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1709_low_46 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 248
Target Start/End: Complemental strand, 31991485 - 31991275
Alignment:
| Q |
37 |
tgattattgacaaggaggtttgaatagctaaattagttttagctaaaagaaatagagttgacctgagttcaaatcagattgaatgagaaaatattaatct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31991485 |
tgattattgacaaggaggtttgaatagctaaattagttttagctaaaagaaatagagttgacctgaattcaaatcagattgaatgagaaaatattaatct |
31991386 |
T |
|
| Q |
137 |
ataacaaactaactcnnnnnnnnagagataacaaactaattattgacatttattagattaaaatattgatggaatattgaattatgaataaaagttacgt |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31991385 |
ataacaaactaactc-tttttttagagataacaaactaattattgacatttgttagattaaaatattgatggaatattgaattatgaataaaagttacgt |
31991287 |
T |
|
| Q |
237 |
gttatctctata |
248 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31991286 |
gttatctctata |
31991275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University