View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17101_high_10 (Length: 224)
Name: NF17101_high_10
Description: NF17101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17101_high_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 132 - 224
Target Start/End: Complemental strand, 17594847 - 17594752
Alignment:
| Q |
132 |
ttaagtataatgtggctgttgattgttttcaaatgtcaataatttactatacccgtgtgccgacaaaagaaaa---ataaatgacaaacttgttat |
224 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17594847 |
ttaagtataatgtggttgttgattgttttcaaatgtcaacaatttactatacccgtgtgccgacaaaagaaaaaagataaatgacaaacttgttat |
17594752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University