View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17101_low_5 (Length: 355)
Name: NF17101_low_5
Description: NF17101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17101_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 17431305 - 17430968
Alignment:
| Q |
1 |
gtaccctattggttttaggttttgcttcgaatcatgctacaatttatttcattagtaggctactggtctattttcactcctatagctatatctattcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431305 |
gtaccctattggttttaggttttgcttcgaatcatgctacaatttatttcattagtaggctactagtctattttcactcctatagctatatctattcaca |
17431206 |
T |
|
| Q |
101 |
cctgattaaaatattttcacaatcataatttaaaacttcacttaaatcagtaggctactagtcttatatgttccatctaaaataatcacttctacaacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17431205 |
cctgattaaaatattttcacaatcataatttaaaacttcacttaaatcagtaggctactagtcttatatgctccatctaaaataatcacttctacaacct |
17431106 |
T |
|
| Q |
201 |
tagacactaatatgcaactactgagctctagcacaggtgattgatgtccagggtgtatgagtgttgtaaaccctggataccgagtttcattcctaatgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431105 |
tagacactaatatgcaactactgagctctagcacaggtgattgatgtccagggtgtatgagtgttgtaaaccctggataccgagtttcattcctaatgat |
17431006 |
T |
|
| Q |
301 |
ataaattggacaaatataagaacatcagaatgaagatc |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17431005 |
ataaattggacaaatataagaacatcagaatgaagatc |
17430968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University