View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17102_high_6 (Length: 398)
Name: NF17102_high_6
Description: NF17102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17102_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 240
Target Start/End: Complemental strand, 40865810 - 40865568
Alignment:
| Q |
7 |
ggagcagagacttaattagggttggatgtgggt--------gatgaagcggttgtaatgtgggtagtgatggtggtcgaggtctaagcattaaaccccct |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40865810 |
ggagcagtgacttaattagggttggatgtgggttggtgggtgatgaagcggttgtaatgtgggtagtgatggtggtcgaggtctaagcattaaaccccct |
40865711 |
T |
|
| Q |
99 |
ttggtgggagagcgatcaccacaaagggaagagacgacaaagacatggcaatgcatgaattgtgacaacgggaaaaacaaagtgcaacttataacaatac |
198 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40865710 |
ttggtgggagagcgaccaccacaaagggaagagacgacaaagacatggcaatgcatgaattgtgacaacggaaaaaacaaagtgcaacttataacaatac |
40865611 |
T |
|
| Q |
199 |
caagctacaaatcaaggtgcagaataata-atatatatttata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
40865610 |
caagctacaaatcaaggtgcagaataatatatatatatatata |
40865568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 270 - 378
Target Start/End: Complemental strand, 40865508 - 40865400
Alignment:
| Q |
270 |
aggcaaccatacaaaaaataagagacactgataagtggctagaacctattaagcatgggcagatttaccgtccggcgagcctgggctcagcggcggatct |
369 |
Q |
| |
|
|||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| | |
|
|
| T |
40865508 |
aggcaaccatacaaaaaataagagacgcagacaagtggctagaacctattaagcatgggcagatttaccgcctggcgagcctgggctcagcggcggattt |
40865409 |
T |
|
| Q |
370 |
tctcctaga |
378 |
Q |
| |
|
||||||||| |
|
|
| T |
40865408 |
tctcctaga |
40865400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University