View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17102_low_16 (Length: 229)
Name: NF17102_low_16
Description: NF17102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17102_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 42517282 - 42517212
Alignment:
| Q |
140 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42517282 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatggacttattggaagtaaaaat |
42517212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 1238706 - 1238636
Alignment:
| Q |
140 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
1238706 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatagacttattgaaagtaaaaat |
1238636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 42517446 - 42517386
Alignment:
| Q |
1 |
ttattggaagaagtttgtcaaaccgacagacgaccataacagtggcagtggacaagcctag |
61 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42517446 |
ttattggaagaagtttgtgaaaccgacagacgaccataacagtggcggtggacaagcctag |
42517386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 41971212 - 41971142
Alignment:
| Q |
140 |
agctctatttaattagagcaccttttgatattttccgtagtttctcatatggacttattggaagtaaaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
41971212 |
agctctatttaattagagcaccttttgatatttttcgtagtttctcatatagacttattgaaagtaaaaat |
41971142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University