View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17102_low_7 (Length: 383)
Name: NF17102_low_7
Description: NF17102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17102_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 78 - 367
Target Start/End: Original strand, 9831111 - 9831396
Alignment:
| Q |
78 |
acacatacaactgtgaggtgctggacttactaatcataagcatgcaattttgatgttaaattttgcatnnnnnnntaatttctcctaactttttagattc |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9831111 |
acacatacaactttgaggtgctggacttgctaatcataaacatgcaatgttgatgttaaattttgcatcaaaaa-taatttctcctaactttttagattc |
9831209 |
T |
|
| Q |
178 |
tctaaaatgcatnnnnnnnnnnnnnnnntgggttggttaagtggtaatgttgagtatgaatgaatgagaagtttggtatggtatatggtagtagttggtt |
277 |
Q |
| |
|
||||||||| || ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9831210 |
tctaaaatgtataaaaaaagcaaaaagatgg-ttggttaagtggta-tgttgagtatgaatgaatgagaagtttggtatggtat--ggtagtagttggtt |
9831305 |
T |
|
| Q |
278 |
agatttagacatgatcaacaaaacagccacatgcaac-nnnnnnnctataaatactccgaacttaactccatttctcttgcgccacattct |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9831306 |
agatttagacatgatcaacaaaacagccacatgcaacaaaaaaaactataaatactccgaacttaactccatttctcttgcgccacattct |
9831396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University