View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17104_high_15 (Length: 298)
Name: NF17104_high_15
Description: NF17104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17104_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 280
Target Start/End: Original strand, 43003265 - 43003536
Alignment:
| Q |
12 |
agcacagagaaaaaggaactagaaaggtaccttggagagtttgttgagagtactgagaatctgaaagtagtatgcttccaagagcatcctcagctcctta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43003265 |
agcacagagaaaaaggaactagaaaggtaccttggagagtttgttgagagtactgagaatctgaaagtagcatgcttccaagagcatcctcagctcctta |
43003364 |
T |
 |
| Q |
112 |
acgacaaaat---tcttgttggcagtggagtagatagccatatttgattcatcaaacagaaaacgttccaatccctctttcattatttgatttataaaga |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003365 |
acgacaaaatatttcttgttggcagtggagtagatagccatatttgattcatcaaacagaaaacgttccaatccctctttcattatttgatttataaaga |
43003464 |
T |
 |
| Q |
209 |
ccttccaaattgttcaatagttcagttctggtctttgatttcagttcacctagaggagtatgtgcctcttgt |
280 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003465 |
ccttccaaattgttcaatagttcagtgctggtctttgatttcagttcacctagaggagtatgtgcctcttgt |
43003536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University