View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17104_high_28 (Length: 219)
Name: NF17104_high_28
Description: NF17104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17104_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 2764048 - 2763845
Alignment:
| Q |
1 |
gacatgccaatgtttttattcannnnnnnattcatgacatgccaatgttctttcacggcattgaattgccaaatttatgcttattcacaatattttacca |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2764048 |
gacatgccaatgtttttattcatttttttattcatgacatgccaatgttctttcacggcattgaattgccaaatttatgcttattcacaattttttacca |
2763949 |
T |
 |
| Q |
101 |
tgcataatgacctaccaaaagctctttaatttcaataatgaatgttaacattctttcatggaaacaaatgttaannnnnnnattagtactcatatgacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
2763948 |
tgcataatgacctaccaaaagctctttaatttcaataatgaatgttaacattctttcagggaaactaatgttaatttttttattagtactcatatgacaa |
2763849 |
T |
 |
| Q |
201 |
gagt |
204 |
Q |
| |
|
|||| |
|
|
| T |
2763848 |
gagt |
2763845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University