View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17104_low_17 (Length: 303)
Name: NF17104_low_17
Description: NF17104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17104_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 32209268 - 32209007
Alignment:
| Q |
19 |
ggcaaggatgttgaggcaaaggaaaattaaggaatcacggtcgcgaaaatgaagggtgtcggaggaattttgctgaggctgtggttggtaaagaatcgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32209268 |
ggcaaggatgttgaggcaaaggaaaattaaggaatcgcggtcgcgacaatgaagggtgtcggaggaattttgctgaggctgtggttggtaaagaattgga |
32209169 |
T |
 |
| Q |
119 |
gggagtactaataaggaaatgaggagaggaacaagggcattgagcaagagatagagagtgtcgttgtttgagtttattgcattagcaatgagagtaaata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32209168 |
gggagtactaataaggaaatgaggagaggaacaagggcattgagcaagagatagagagtgtcgttgtttgagtttattgcattggcaatgagagtaaata |
32209069 |
T |
 |
| Q |
219 |
aagctgcacttacaccattgaaactaacactcaaagataatgcaagtgaacggttacttgtg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32209068 |
aagctgcacttacaccattgaaactaacactcaaagataatgcaagtgaacggtttcttgtg |
32209007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University