View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17104_low_21 (Length: 278)
Name: NF17104_low_21
Description: NF17104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17104_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 34693477 - 34693251
Alignment:
| Q |
1 |
tatctattttggttgccaagtagtaaatgccaatacgtagaatctgaaatatctggtggcgtactcatcccagcaacttttcaaaccaaaaagaagcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34693477 |
tatctattttggttgccaagtagtaaatgccaatacgtagaatctgaaatatctggtggcgtactcatcccagcaacttttcaaaccaaaaagaagcaca |
34693378 |
T |
 |
| Q |
101 |
tgctgtaccggccagtaataataaattttagtacttttgatctcatctcaatctaaagcaaatttaaattcacgaatacgtttgagtaggtaaaagtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34693377 |
tgctgtaccggccagtaataataaattttagtacttttgatctcatctcaatctaaagcaaatttaaattcacgaatacgtttgagtaggtaaaagtata |
34693278 |
T |
 |
| Q |
201 |
ctatccattattaatgatatacgtacg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34693277 |
ctatccattattaatgatatacgtacg |
34693251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 221 - 263
Target Start/End: Complemental strand, 34693238 - 34693196
Alignment:
| Q |
221 |
acgtacgggcatgtgtatattggaggaaattaactaagttttt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34693238 |
acgtacgggcatgtgtatattggaggaaattaactaagttttt |
34693196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University