View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17105_high_1 (Length: 405)
Name: NF17105_high_1
Description: NF17105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17105_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 1432985 - 1432804
Alignment:
| Q |
1 |
ttttgcattttgccgcaatataaaggtttgcaacgtaactgcgttcgcggccacagtttgaaaccatgagtttgatcactgacaaaaatggaatttcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432985 |
ttttgcattttgccgcaatataaaggtttgcaacgtaactgcgttcgcggccacagtttgaaaccatgagtttgatcactgacaaaaatggaatttcaga |
1432886 |
T |
|
| Q |
101 |
agaaaagnnnnnnngtgttgtgtaataggaaagatagaatctgtgtagaagctatgtcaagcaatcaaaccaggtggaataa |
182 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432885 |
agaaaagtttttttgtgttgtgtaataggaaagatagaatctgtgaagaagctatgtcaagcaatcaaaccaggtggaataa |
1432804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 301 - 403
Target Start/End: Complemental strand, 1432684 - 1432582
Alignment:
| Q |
301 |
attgaaatgaaatttgcataacagtgaagttatcaatggttttgagttttgacttttatgtttgaggcttgtttctgtaaagtgaaatttggcctttgct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
1432684 |
attgaaatgaaatttgcataacagtgaagttatcaatggttttgagttttgacttttatgtttgaggcttgtttctgtaaagtgaaatttggcttttgat |
1432585 |
T |
|
| Q |
401 |
tct |
403 |
Q |
| |
|
||| |
|
|
| T |
1432584 |
tct |
1432582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 5 - 39
Target Start/End: Original strand, 37281138 - 37281172
Alignment:
| Q |
5 |
gcattttgccgcaatataaaggtttgcaacgtaac |
39 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
37281138 |
gcattttgccgcaatataaaggtttgcagcgtaac |
37281172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 18573513 - 18573545
Alignment:
| Q |
7 |
attttgccgcaatataaaggtttgcaacgtaac |
39 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
18573513 |
attttaccgcaatataaaggtttgcaacgtaac |
18573545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University