View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17105_high_2 (Length: 245)
Name: NF17105_high_2
Description: NF17105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17105_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 1432963 - 1433160
Alignment:
| Q |
1 |
ttatattgcggcaaaatgcaaaaaatgcggttatggttctgttgcggagacatcaaaatcatttatattgcggaccgcaatttaaaaccatgatcaaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1432963 |
ttatattgcggcaaaatgcaaaaaatgcggttatggtgctgttgcggagacatcaaaatcatttatattgcggaccgcaatttaaaaccatgatcaaact |
1433062 |
T |
 |
| Q |
101 |
cattgaaaacagaaaagaaagnnnnnnnncaatgtgaacacaagaaaatcaatgaagacataaactcataatgaacatgaaacaaatgaaactgaact |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
1433063 |
cattgaaaacagaaaagaaagaaaaaaaacaatgtgaacacaagaaaatcaatgaagacataaattcataaagaacatgaaacaaatgaaactgaact |
1433160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University