View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17106_high_18 (Length: 217)

Name: NF17106_high_18
Description: NF17106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17106_high_18
NF17106_high_18
[»] chr2 (1 HSPs)
chr2 (18-202)||(5190580-5190764)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 5190764 - 5190580
Alignment:
18 aaaactacgtgcagttatgcagtcaaaacaattgcacgcagtttcaactgcaacatgcaaatttgattgcatgcaatctcgctttgaaatgaaagtacaa 117  Q
    |||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||    
5190764 aaaagtacgtgcagttatgcagtcaaaacaactacacgcagtttcaactgcaacatgcaaatttaattgaatgcaatttcgctttgaaatgaaagtacaa 5190665  T
118 tgtttcaataatttagcttttatgcaaaattgaaaagctttttattttgcnnnnnnntatttttatgtctctaaattctaatttt 202  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||       ||||||||||||||||||||||||||||    
5190664 tgtttcaataatttagcttttatgcaaaattgaaaagcttttaattttgcaaaaaattatttttatgtctctaaattctaatttt 5190580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University