View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17107_low_14 (Length: 250)
Name: NF17107_low_14
Description: NF17107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17107_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 10660810 - 10661047
Alignment:
| Q |
4 |
tcaaatttcgcaggtgcttaacgcagcaatgctatattggccaatgcctaatgcattatatgttgaaggttatgctcttgacagatttgcagaagggtca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10660810 |
tcaaatttcgcaggtgcttaacgcagcaatgctatattggccaatgcctaatgcattatatgttgaaggttatgctcttgacagatttgcagaagggtca |
10660909 |
T |
|
| Q |
104 |
tgggccttacagcctgttcaccaaaatagggtaagcctcaactataatatattggattgtgctgcctgcatccttgactagtttatgacatacaatgttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10660910 |
tgggccttacagcctgttcaccaaaatagggtaagcctcaactataatatattggattgtgctgcctgcatccttgactagtttatgacaaacaatgttg |
10661009 |
T |
|
| Q |
204 |
ctttcttcattatgctgtttcttttcaactagaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661010 |
ctttcttcattatgctgtttcttttcaactagaataat |
10661047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University