View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17107_low_20 (Length: 223)

Name: NF17107_low_20
Description: NF17107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17107_low_20
NF17107_low_20
[»] chr5 (1 HSPs)
chr5 (17-204)||(5723247-5723434)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 5723247 - 5723434
Alignment:
17 aatatcaccgacaaaagaccgatggaagtatggaacaaagagcatgataaatggatcttcggactaaaactgcatctggaagtttggcagagattagaaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
5723247 aatatcaccgacaaaagaccgatggaagtatggaacaaagagcatgataaatggatcttcggattaaaactgcatctggaagtttggcagagattagaaa 5723346  T
117 agcacagaatgaaatataaagtgaaatcaatgaagaaaatgataatgcattcatatagttaaaaccaaatgaaggaacatgaatcttt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5723347 agcacagaatgaaatataaagtgaaatcaatgaagaaaatgataatgcattcatatagttaaaaccaaatgaaggaacatgaatcttt 5723434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University