View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17107_low_8 (Length: 358)
Name: NF17107_low_8
Description: NF17107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17107_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 124 - 342
Target Start/End: Complemental strand, 36773786 - 36773568
Alignment:
| Q |
124 |
ctgcaggcgacacacggacgatgatggagtatcaaagtgactacttgatgttgtaactgatgtaattgcatatcattatttacagcattgtagtagtatg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36773786 |
ctgcaggcgacacacggacgatgatggaggatcaaagtgactacttgatgttgtaactgatgtaattgcatatcattatttacagcattgtagtagtatg |
36773687 |
T |
 |
| Q |
224 |
aatatctcttattccattgcataaaaataaaaatagtatttgacacattttgatagttacatatttccattttgatatatcaaaaaattttacattactt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36773686 |
aatatctcttattccattgcataaaaataaaaatagtatttgacacattttgatagttacatatttccattttgatatatcaaaaaaatttacattactt |
36773587 |
T |
 |
| Q |
324 |
tagaatcaagcctaagtat |
342 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36773586 |
tagaatcaagcctaagtat |
36773568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 36773924 - 36773864
Alignment:
| Q |
1 |
tctcttttatattgtttgtctgtgtttaatgtcgtatggggcacgtttaaaattaatggca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36773924 |
tctcttttatattgtttgtctgtgtttaatgtcgtatggggcacgtttaaaatcaatggca |
36773864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University