View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_high_21 (Length: 300)
Name: NF17108_high_21
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 18415631 - 18415758
Alignment:
| Q |
1 |
cttatgctctctgattttgatgtcttcactggaatcttatggccaaacttgtattgtgtggaaataggtttatgattcacaaaaccccatatgtatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18415631 |
cttatgctctctgattttgatgtcttcactggaatcttatggccaaacttgtattgtgtggaaataggtttatgattcacaaaaccccatatgtatttgt |
18415730 |
T |
 |
| Q |
101 |
caaatgaaccaaagtccttgttaacctg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18415731 |
caaatgaaccaaagtccttgttaacctg |
18415758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 190 - 295
Target Start/End: Original strand, 18415820 - 18415923
Alignment:
| Q |
190 |
gattatgtagggtttcagggatcccacttgtgtgacattgtggctgtggcaggaatgtcacgtgacattgctcaaccataatgtgacacgtattttgttt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
18415820 |
gattatgtagggtttcagggatcccacttgtgtaacactgtggctgtggcaggaatgtcacgtgacattgcccaaccataatgtgata--tattttgttt |
18415917 |
T |
 |
| Q |
290 |
tgtttc |
295 |
Q |
| |
|
|||||| |
|
|
| T |
18415918 |
tgtttc |
18415923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 26801902 - 26802015
Alignment:
| Q |
1 |
cttatgctctctgattttgatgtcttcactggaatcttatggccaaacttgtattgtgtggaaataggtttatgattcacaaaaccccatatgtatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||| |||||||| | || || ||||||||||||||||| ||||| |||||||| | |
|
|
| T |
26801902 |
cttatgctctctgattttgatgtcttcactggaatcttgtgaccaaatttgtattgatttgagattggtttatgattcacaaacccccaaatgtatttgt |
26802001 |
T |
 |
| Q |
101 |
caaatgaaccaaag |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26802002 |
caaatgaaccaaag |
26802015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 278
Target Start/End: Complemental strand, 38143078 - 38143034
Alignment:
| Q |
234 |
tgtggcaggaatgtcacgtgacattgctcaaccataatgtgacac |
278 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
38143078 |
tgtggcgggaatgtcgcatgacattgctcaaccacaatgtgacac |
38143034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University