View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_high_22 (Length: 291)
Name: NF17108_high_22
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 7412946 - 7412806
Alignment:
| Q |
17 |
acaagcaaacttgcattttgccacgaaatgatcctccatctccttaacttctgggcactacggacacttagtctttgtttgggagtttggagggcatggg |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
7412946 |
acaagcaaacatgcattttgccacgaaatgatcctccatctccttaacttctgggcactacggacacttaggctttgtttgggagtttggagggcatgag |
7412847 |
T |
 |
| Q |
117 |
aatgaagggtggaaaacataaggaaaaattgataaatcttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7412846 |
aatgaagggtggaaaacataaggaaaaattgataaatcttt |
7412806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University