View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_high_45 (Length: 220)
Name: NF17108_high_45
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 14 - 133
Target Start/End: Complemental strand, 32467557 - 32467436
Alignment:
| Q |
14 |
attatacttaaaatagatatatttatatagcatagaatatttatacatcttatatccaaatttcattg--ctctcaatatgagcatcttgggctagaata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32467557 |
attatacttaaaatagatatatttatatagcatagaatatttatacatcttatatccaaattccattgctctctcaatatgagcatcttgggctagaata |
32467458 |
T |
 |
| Q |
112 |
tgagctaatttattattacttc |
133 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32467457 |
tgagctaatttattattacttc |
32467436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 176 - 205
Target Start/End: Complemental strand, 32467420 - 32467391
Alignment:
| Q |
176 |
tattactaagattgcttgttgttatttctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32467420 |
tattactaagattgcttgttgttatttctt |
32467391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University