View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_19 (Length: 325)
Name: NF17108_low_19
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 42 - 124
Target Start/End: Complemental strand, 40576005 - 40575923
Alignment:
| Q |
42 |
cttcagctcaagtgttgatatacaccagattggcttcaataattcaattccaaaattggcaaaaagcagaaacaaagtaccaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576005 |
cttcagctcaagtgttgatatacaccagattgacttcaataattcaattccaaaattggcaaaaagcagaaacaaagtaccaa |
40575923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 47 - 100
Target Start/End: Complemental strand, 19860362 - 19860309
Alignment:
| Q |
47 |
gctcaagtgttgatatacaccagattggcttcaataattcaattccaaaattgg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19860362 |
gctctagtgttgatatacaccagattggcttcaataattcaatttcaaaattgg |
19860309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 227
Target Start/End: Complemental strand, 19852339 - 19852260
Alignment:
| Q |
148 |
tctaaaaactctaattgaatgacaatattacacggtcaacccacattgtttataaatatattatactacatgattttctt |
227 |
Q |
| |
|
||||||||||||| |||| |||||||| || || ||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
19852339 |
tctaaaaactctatttgagtgacaataataagaagttaacacacattgtttataaatataatatactacataattttctt |
19852260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University