View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_27 (Length: 290)
Name: NF17108_low_27
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 26218412 - 26218675
Alignment:
| Q |
13 |
aataaattcattgtatgtgatggtcataggtggagcgtaggcacaacatgcatattggtacagggaactaaatggattgcagatggatccactctacatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26218412 |
aataaattcattgtatgtgatggtcataggtggagcgtaggcaca---tgcatattggtacagggaactaaatggattgcagatggatccactctacatc |
26218508 |
T |
|
| Q |
113 |
ttcctacttaaagcgaatataatcttaagcaactaaagccacagaggacaagttgatatggatgctcgaaaagcatggaaatttctttgttaaaaacaca |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26218509 |
ttcctacttaaagcgagtataatcttaagcaactaaagccacagaggacaagttgatacggatgctcgaaaaggatggaaatttctttgttaaaaacaca |
26218608 |
T |
|
| Q |
213 |
tatcgttcctgtatttgtatgggtgctagtagctcgaacatccagactccgggagttggcaattcat |
279 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26218609 |
tatcattcctgtatttgtatgggtgctggtagctcgaacatccaaactccgggagttggcaattcat |
26218675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University